Write a function that determines if a sequence of base pairs is DNA, RNA, or if
it is not possible to tell given the sequence provided. RNA has the base Uracil
("u") instead of the base Thymine ("t"), so sequences with u’s are RNA,
sequences with t’s are DNA, and sequences with neither are unknown.
You can check if a string contains a character (or a longer substring) in R
using grepl(substring, string), so grepl("u", sequence) will check if the
string in the sequence variable has the base u.
Name the function dna_or_rna() and have it take sequence as an argument.
Have the function return one of three outputs: "DNA", "RNA", or "UNKNOWN".
Add documentation describing what the function does. Call the function on each
of the following sequences.
seq1 <- "ttgaatgccttacaactgatcattacacaggcggcatgaagcaaaaatatactgtgaaccaatgcaggcg"
seq2 <- "gauuauuccccacaaagggagugggauuaggagcugcaucauuuacaagagcagaauguuucaaaugcau"
seq3 <- "gaaagcaagaaaaggcaggcgaggaagggaagaagggggggaaacc"
Challenge (optional): Figure out how to make your function work with both upper and lower case letters, or even strings with mixed capitalization*
[click here for output]